For information and reference only – not to be submitted as your own work. This is a model-answer extract showing structure, depth and referencing for a Milestone 1 diagnostic-test report. All primer sequences, positions and Tm values are illustrative: they are invented to show the method and are not taken from the ZRV2 sequence card. Your team must design its own primers from the card. The brief bans AI tools; this sample was written by a human specialist for study only. Follow your institution’s academic integrity rules.
This sample follows the Drug Discovery Series Assignment 2 “Find It” task. For the full explanation of the method, read how to design a PCR test for a gene deletion.
1. Why PCR and an agarose gel suit Dr Walsh’s lab
The ZRV2 deletion removes 186 bp from exon 3 (nt 3,412–3,597). Exon 3 runs from nt 3,290 to 3,712, so it is 423 bp long and the deletion removes about 44.0% of it (186 ÷ 423). Because 186 ÷ 3 = 62, the loss is a multiple of three, so the reading frame downstream should be preserved.
A size difference of 186 bp is large enough to see on a standard agarose gel. PCR across the deletion therefore converts a genotype question into a band-size question, which is cheap, fast and readable by a non-specialist (Saiki et al., 1988; Lee et al., 2012).
| Method | Low cost | Fast | Shows one copy or two | Easy to read | Total |
|---|---|---|---|---|---|
| PCR across the deletion + agarose gel | 5 | 5 | 4 | 4 | 18 |
| DNA sequencing | 2 | 3 | 4 | 2 | 11 |
| Southern blot | 2 | 1 | 4 | 3 | 10 |
Scores are one team’s illustrative judgement, not fixed answers. Your team should justify its own.
2. Primer table (illustrative values)
The forward primer sits upstream of nt 3,412 and is copied from the top strand. The reverse primer sits downstream of nt 3,597 and is written as the reverse complement of the top strand, so that both primers extend towards each other across the deletion (Dieffenbach, Lowe and Dveksler, 1993).
| Primer | Sequence (5′→3′) – ILLUSTRATIVE | Position (nt) | Length | GC content | Tm (Wallace) | 3′ end |
|---|---|---|---|---|---|---|
| Forward | AGCTGACCTTGAGCAGTCAG | 3,301–3,320 | 20 | 55% (11/20) | 62 °C | G |
| Reverse | TCCAGGTTCAGCATGACAGC | 3,701–3,720 (binds bottom strand) | 20 | 55% (11/20) | 62 °C | C |
Wallace rule: Tm ≈ 2 °C × (A+T) + 4 °C × (G+C). For the forward primer, 2 × 9 + 4 × 11 = 62 °C (Wallace et al., 1979). The rule was developed for short oligonucleotides, so both values should then be checked with an online calculator or Primer3, which uses nearest-neighbour thermodynamics (Untergasser et al., 2012). The two primers’ Tm values are within 1 °C of each other, which supports one shared annealing temperature.
3. Product sizes with working (illustrative)
| Template | Working | Product |
|---|---|---|
| Normal ZRV2 allele | 3,720 − 3,301 + 1 | 420 bp |
| Deleted allele | 420 − 186 | 234 bp |
A 186 bp gap between 420 bp and 234 bp separates clearly on a 2% agarose gel beside a 100 bp ladder (Lee et al., 2012).
4. Expected gel and key
| Lane | Sample | Expected bands |
|---|---|---|
| 1 | 100 bp DNA ladder | Reference sizes |
| 2 | Two normal copies | 420 bp only |
| 3 | One deleted copy (heterozygous) | 420 bp and 234 bp |
| 4 | Two deleted copies (homozygous) | 234 bp only |
| 5 | Positive control (known heterozygous DNA) | 420 bp and 234 bp |
| 6 | Negative control (no DNA) | No band |
| Pattern | Meaning | What the lab does next |
|---|---|---|
| One large band (420 bp) | No deletion detected | Report negative if controls are correct |
| Two bands (420 + 234 bp) | One deleted copy | Report positive (heterozygous) |
| One small band (234 bp) | Two deleted copies | Report positive (homozygous) |
| No bands in any lane | PCR or gel failed | Do not report; check reagents and repeat |
| Band in negative control | Contamination | Discard the run; clean workspace and repeat |
Heterozygous samples can occasionally show a faint extra band above the 420 bp product, formed when one normal and one deleted strand anneal to each other. Mentioning this in the key shows the marker that you have thought about unexpected bands.
Need your own primers checked? Our molecular biology team can review your design and explain any errors. Send your draft for expert guidance.
5. Flow diagram: sample to report
- Collect sample – blood in an EDTA tube or a cheek swab; quick and low-cost.
- Label and log – unique ID on tube and form, so results cannot be mixed up.
- Extract DNA – spin-column kit; removes protein that would inhibit PCR.
- Check DNA – spectrophotometer A260/A280; confirms enough clean DNA.
- Set up PCR – master mix, primers, patient DNA, plus positive and negative controls; controls prove the run worked and is clean.
- Thermal cycling – about 30 cycles of denaturation (~95 °C), annealing (~57 °C, a few degrees below Tm) and extension (72 °C); amplifies the target.
- Run the gel – 2% agarose with a ladder; separates 420 and 234 bp products.
- Image the gel – DNA stain under UV or blue light; makes bands visible.
- Read against the key – check controls first, then patient lanes; avoids false results.
- Report to Dr Walsh – plain-language result within two working days.
6. Note for Dr Walsh
Positive: Your patient carries the ZRV2 exon 3 deletion on one copy (two bands) or both copies (one small band). Using the figures given in the brief, this deletion is found in most people with KVS but also in a small number of healthy people, so it supports, rather than proves, the diagnosis.
Negative: No deletion was found, but this does not rule out KVS, because about 28% of patients with KVS do not carry it (figure from the brief).
7. Glossary extract
| Term | Own-words definition | Source |
|---|---|---|
| Primer | A short single strand of DNA that marks where copying starts. | Dieffenbach, Lowe and Dveksler (1993) |
| Reverse complement | The sequence read backwards with each base swapped for its partner. | Phillips et al. (2008) |
| Melting temperature (Tm) | The temperature at which half of a primer has come away from its target. | Wallace et al. (1979) |
Want a specialist to walk you through your own team’s milestone? Submit your assignment details or explore our biotechnology assignment help. Related reading: the ANSC20010 Genetics and Biotechnology assignment example and our Harvard referencing guide.
About the expert
Siobhan Murphy holds a Ph.D. in Molecular Biology from Trinity College Dublin and has 2,365 completed orders on Ireland Assignment Help.
References
Dieffenbach, C.W., Lowe, T.M. and Dveksler, G.S. (1993) ‘General concepts for PCR primer design’, PCR Methods and Applications, 3(3), pp. S30–S37.
Lee, P.Y., Costumbrado, J., Hsu, C.-Y. and Kim, Y.H. (2012) ‘Agarose gel electrophoresis for the separation of DNA fragments’, Journal of Visualized Experiments, (62), e3923. doi:10.3791/3923.
Phillips, A.R., Robertson, A.L., Batzli, J., Harris, M. and Miller, S. (2008) ‘Aligning goals, assessments, and activities: an approach to teaching PCR and gel electrophoresis’, CBE—Life Sciences Education, 7(1), pp. 96–106. doi:10.1187/cbe.07-07-0052.
Saiki, R.K. et al. (1988) ‘Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase’, Science, 239(4839), pp. 487–491.
Untergasser, A. et al. (2012) ‘Primer3—new capabilities and interfaces’, Nucleic Acids Research, 40(15), e115.
Wallace, R.B. et al. (1979) ‘Hybridization of synthetic oligodeoxyribonucleotides to φX174 DNA: the effect of single base pair mismatch’, Nucleic Acids Research, 6(11), pp. 3543–3557.
